View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_380 (Length: 250)
Name: NF10481A_low_380
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_380 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 31 - 250
Target Start/End: Original strand, 46898152 - 46898371
Alignment:
| Q |
31 |
cattcatcatataatacatggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgagcgtctcaacatccatatcggcaga |
130 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46898152 |
cattcatcatataatgcatggtacacaactctttccacttgatacctcttcctctttgctctcatactgacttgagcgtgtcaacatccatatcggcaga |
46898251 |
T |
|
| Q |
131 |
cactgttcatgctcggcccattgtttttgttcgattatgcctaaaaacacacttgattatattggtttnnnnnnncatgctagacctatgtcaaatcacc |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
46898252 |
cactgttcatgctcggcccattgtttttgttcgatcacgcctaaaaacacacttgattatattggtttaaaaaaacatgctagacctatgtcaaattacc |
46898351 |
T |
|
| Q |
231 |
ttgactacaaataccttatc |
250 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
46898352 |
ttgactacaaataacttatc |
46898371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 50 - 106
Target Start/End: Original strand, 32715228 - 32715284
Alignment:
| Q |
50 |
ggtacacaactctttccacttgatacctcttcttctttgctctcatactgacttgag |
106 |
Q |
| |
|
||||||||| || ||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
32715228 |
ggtacacaattccttccacttgatacctctcactctttgctctcatactaacttgag |
32715284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University