View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_389 (Length: 250)
Name: NF10481A_low_389
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_389 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 250
Target Start/End: Complemental strand, 24245241 - 24245001
Alignment:
| Q |
10 |
aatatcagaaagcaaatgtgcagcatcactgataacagataagctgtgagctttcaaacccccaacaaattcaacaatcataacaatagcatagaaaact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24245241 |
aatatcagaaagcaaatgtgcagcatcactaataacagataagctgtgagctttcaaacccccaacaaattcaacaatcataacaatagcatagaaaact |
24245142 |
T |
|
| Q |
110 |
attagtaaagaaagtttcttcgcggactcattcgacactccaacactcttttccttcgaagaaaaacgacaaacagaatttttgcgcgaggataatgaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
24245141 |
attagtaaagaaagtttcttcgcggactcattcgacgctccaacactcttttccttcgaagaaaaacgacaaacagaatttttgcgcgaggaaagtgaca |
24245042 |
T |
|
| Q |
210 |
atgttgccataggtattccagttcactctattgctcttgca |
250 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
24245041 |
atgttgtcataggtattccagtttcctctattgatcttgca |
24245001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University