View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_400 (Length: 250)
Name: NF10481A_low_400
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_400 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 180 - 245
Target Start/End: Complemental strand, 22659782 - 22659717
Alignment:
| Q |
180 |
gtacaagctaaatgcagaaaagatggaatcaaatttacttgaaaaaatcaaggaagaacaccatac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22659782 |
gtacaagctaaatgcagaaaagatggaatcaaatttacttgaaaaaatcgaggaagaacaccatac |
22659717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 9 - 82
Target Start/End: Complemental strand, 33622198 - 33622125
Alignment:
| Q |
9 |
gtttccatgtttctcccttttttctcgtgtctacaagcaatatcaccgtgattttataactctagaattcctaa |
82 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33622198 |
gtttccatgtttctctcttttttctcgtgtctcagagcaatatcaccgtgatttcataactctagaattcctaa |
33622125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 189 - 242
Target Start/End: Complemental strand, 28967923 - 28967870
Alignment:
| Q |
189 |
aaatgcagaaaagatggaatcaaatttacttgaaaaaatcaaggaagaacacca |
242 |
Q |
| |
|
|||||||||||| ||| |||||| |||||||||| |||| ||||||||||||| |
|
|
| T |
28967923 |
aaatgcagaaaaaatgaaatcaagtttacttgaagaaatataggaagaacacca |
28967870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University