View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_404 (Length: 249)
Name: NF10481A_low_404
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_404 |
 |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 47 - 228
Target Start/End: Original strand, 929746 - 929927
Alignment:
| Q |
47 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagcaaaatgcattagattgtatccatc |
146 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
929746 |
aaccattttaatatgcgacactatgccgcttacattcattgagtttccttcaaagataatttgatttctacctagaaaaatgcattagattgtatccatc |
929845 |
T |
 |
| Q |
147 |
catacacgataaatgtgagaatttcctacctttcttcccacctttgataccacaatgttgcaaaaattgagagcacaggttc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
929846 |
catacacgataaatgtgagaatttcctacctttcttaccacctttgataccacaatgttgcaaaaattgagagcacgggttc |
929927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 156 - 218
Target Start/End: Complemental strand, 24981 - 24919
Alignment:
| Q |
156 |
taaatgtgagaatttcctacctttcttcccacctttgataccacaatgttgcaaaaattgaga |
218 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||||||||||||||||| |||||||| || ||||| |
|
|
| T |
24981 |
taaatgtgagcatttcctatctttcttaccacctttgataccacagtgttgcaataaatgaga |
24919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University