View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_405 (Length: 249)
Name: NF10481A_low_405
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_405 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 9 - 229
Target Start/End: Original strand, 30411012 - 30411230
Alignment:
| Q |
9 |
atcagagaacagtgctaatgatgatgaacaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatggagccaatg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
30411012 |
atcagaaaacagtgctaatgatgatgatcaagcagtcctgcaacaagatatctagttcttaaaagagtcatggtccaaccttgttgagatgaagccaatg |
30411111 |
T |
 |
| Q |
109 |
atggtgactttgaacaagatctcaatgctgtcaagtaacaggtcaggaggtaaatacagctagaaacttgattggtaagttacctgcagaaacatctttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30411112 |
atggtgactttgaacaagatctcaatgctgtcaa--tacaggtcaggaggcaaatacatctagaaacttgattggtaagttacctgcagaaacatctttg |
30411209 |
T |
 |
| Q |
209 |
tccaaagaagcagatgctctt |
229 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30411210 |
tccaaagaagcagatgctctt |
30411230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University