View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_410 (Length: 249)
Name: NF10481A_low_410
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_410 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 215
Target Start/End: Original strand, 5956973 - 5957183
Alignment:
| Q |
5 |
gcgggctggtgttgatggataccatattaatgttggcggtcgccacatgacttcgtttccataccgaacagtaagttaattgagatgtggcagatgtttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5956973 |
gcgggctggtgttgatggataccatattaatgttggcggtcgccacatgacttcgtttccataccgaacagtaagttaattgagatgtggcagatgtttt |
5957072 |
T |
|
| Q |
105 |
tgtctcatgcttgcaccaagttgatgaagtgaaattgtatattttgattatgcattgctatcaattttcatggcgataggtttcctaatgttgttacttt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5957073 |
tgtctcatgcttgcaccaagttgatgaagtgaaattgtatattttgattatgtattgctatcaattttcatggtgataggtttcctaatgttgttacttt |
5957172 |
T |
|
| Q |
205 |
tattttaccat |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
5957173 |
tattttaccat |
5957183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University