View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_414 (Length: 248)
Name: NF10481A_low_414
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_414 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 49375631 - 49375409
Alignment:
| Q |
1 |
gagaaagaaattttagggctctgtcaaatagtgaatgagaaaaataggagtatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtattt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49375631 |
gagaaagaaattttagggctctttcaaatagtgaatgagaaaaataggagtatggtatgagttaggatgttggcgtgggaaataaaaatggggtgtattt |
49375532 |
T |
|
| Q |
101 |
agcagtgcatgtagaaaattgcaaagaaaaaagtttgttaactttgggcttcaatcgagaacagaaacagaactagtcgtccacagccacttctcaacgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||||||||||| |
|
|
| T |
49375531 |
agcagtgcatgtagaaaattgcaaagaaaaaagtttgttaactttgggcttcaatcgagaacagaaacaggactagtcatccatagccacttctcaacgg |
49375432 |
T |
|
| Q |
201 |
catttatagaagactgttactttt |
224 |
Q |
| |
|
|||||||| |||||| |||||||| |
|
|
| T |
49375431 |
catttata-aagactattactttt |
49375409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University