View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_422 (Length: 247)
Name: NF10481A_low_422
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_422 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 35449811 - 35450052
Alignment:
| Q |
1 |
aacatcattagagaaagagatgaagcacaagaaaaatgtgaaagacgtctcgtggaaaagctagttttccatcaacaacaaaatgctccactttccggag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35449811 |
aacatcattagagaaagagatgaagcacaagaaaaatgtcaaagacttctcttggaaaagctagttttccatcaacaacaaaatgatccactttccggag |
35449910 |
T |
|
| Q |
101 |
tttcaagcattgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcatcagattgtgaagaaagcattgtttcttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
35449911 |
tttcaagcattgaagatgaacaagttacaagaaaaggaattgactcaaacaatggtttttctttgtcttcttcagattgtgaagaaagcattgtttcttc |
35450010 |
T |
|
| Q |
201 |
accaattattgatcaatcaatgattgaagtactaacaccaaa |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35450011 |
accaattattgatcaatcaatgattgaagtactaacaccaaa |
35450052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 21010701 - 21010633
Alignment:
| Q |
10 |
agagaaagagatgaagcacaagaaaaatgtgaaagacgtctcgtggaaaagctagttttccatcaacaa |
78 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| | || | |||||| || ||||||| |||||| |
|
|
| T |
21010701 |
agagaaagagatgaagcacaagaaaaatgccaaagacttttcttagaaaagttacttttccaacaacaa |
21010633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University