View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_432 (Length: 246)
Name: NF10481A_low_432
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_432 |
 | |
|
| [»] scaffold0036 (1 HSPs) |
| |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0036 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 3 - 246
Target Start/End: Complemental strand, 56560 - 56317
Alignment:
| Q |
3 |
gagtttggtgttgggatgcattccgcagctgagttttccaattcagctcatataactaccggtattattagcattacagacattatttacagtggcaata |
102 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56560 |
gagtttgctgttgggatgcattccgcagctgagttttccaattcagctcatataactaccggtattattagcattacagacattacttacagtggcaata |
56461 |
T |
|
| Q |
103 |
tgatggattggatggccggcaagaatggaggttttgacaccataatgtctactgaattttcccaaactgctgctattaactctgctactggcttggtctg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56460 |
tgatggattggatggccggcaagaatggaggttttgacaccataatgtctaatgaattttcccaaactgctgctattaactctgctactggcttggtctg |
56361 |
T |
|
| Q |
203 |
taggaaaactgcatgtatgttatcacatggttgggtttacttga |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56360 |
taggaaaactgcatgtatgttatcacatggttgggtttacttga |
56317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 27 - 246
Target Start/End: Original strand, 40738360 - 40738591
Alignment:
| Q |
27 |
gcagctgagttttccaattcagctcatataactaccggtattattagcattacagacattatttacagtggcaatatgatggattggatggccggcaaga |
126 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| | ||||| || |||||||||||||||| || || |||||| |||||||||||||| ||||||| |
|
|
| T |
40738360 |
gcagctgagtcatccaattcagctcatataactgcaggtatgatcagcattacagacattacttttagaggcaatgcgatggattggatggtgggcaaga |
40738459 |
T |
|
| Q |
127 |
atggaggttttgacaccataatgtctactgaattttcccaaactgctgctattaactctgcta---------------ctggcttggtctgtaggaaaac |
211 |
Q |
| |
|
||||||||||| ||||| | |||||||||| ||||||||||||| || ||||| |||||| |||||||||||||||| ||||| |
|
|
| T |
40738460 |
atggaggttttaacaccgttatgtctactgggttttcccaaactgatg---ttaaccctgctactttggtgcctatttctggcttggtctgtagcaaaac |
40738556 |
T |
|
| Q |
212 |
tgcatgtatgttatcacatggttgggtttacttga |
246 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
40738557 |
tgcatttatgttatcacatggttgggttttcttga |
40738591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University