View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_439 (Length: 245)
Name: NF10481A_low_439
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_439 |
 | |
|
| [»] scaffold0041 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0041 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 87589 - 87814
Alignment:
| Q |
1 |
gctaatcatgagacggatgaagtctatgcaaaactcaggcttgttcctatgaatattaacgaggttagttttgataatgacggtgttgctggcaccaacg |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
87589 |
gctaatcatgagaccgatgaagtgtatgcaaaactcagacttgtccctatgaatattaaccaggttagttttgataatgatggtgttgctggcatcaacg |
87688 |
T |
|
| Q |
101 |
tgtctgaaactaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
200 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
87689 |
tgtccgaaacaaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
87788 |
T |
|
| Q |
201 |
aacgctttttcctcgtttggactatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
87789 |
aacgctttttcctcgtttggactatt |
87814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 95605 - 95830
Alignment:
| Q |
1 |
gctaatcatgagacggatgaagtctatgcaaaactcaggcttgttcctatgaatattaacgaggttagttttgataatgacggtgttgctggcaccaacg |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
95605 |
gctaatcatgagaccgatgaagtgtatgcaaaactcagacttgtccctatgaatattaaccaggttagttttgataatgatggtgttgctggcatcaacg |
95704 |
T |
|
| Q |
101 |
tgtctgaaactaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
200 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
95705 |
tgtccgaaacaaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
95804 |
T |
|
| Q |
201 |
aacgctttttcctcgtttggactatt |
226 |
Q |
| |
|
|| | ||||||||||| ||||||||| |
|
|
| T |
95805 |
aatgatttttcctcgtatggactatt |
95830 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 40878694 - 40878469
Alignment:
| Q |
1 |
gctaatcatgagacggatgaagtctatgcaaaactcaggcttgttcctatgaatattaacgaggttagttttgataatgacggtgttgctggcaccaacg |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
40878694 |
gctaatcatgagaccgatgaagtgtatgcaaaactcagacttgtccctatgaatattaaccaggttagttttgataatgatggtgttgctggcatcaacg |
40878595 |
T |
|
| Q |
101 |
tgtctgaaactaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
200 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40878594 |
tgtccgaaacaaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
40878495 |
T |
|
| Q |
201 |
aacgctttttcctcgtttggactatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40878494 |
aacgctttttcctcgtttggactatt |
40878469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 40870677 - 40870452
Alignment:
| Q |
1 |
gctaatcatgagacggatgaagtctatgcaaaactcaggcttgttcctatgaatattaacgaggttagttttgataatgacggtgttgctggcaccaacg |
100 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
40870677 |
gctaatcatgagaccgatgaagtgtatgcaaaactcagacttgtccctatgaatattaaccaggttagttttgataatgatggtgttgctggcatcaacg |
40870578 |
T |
|
| Q |
101 |
tgtctgaaactaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
200 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40870577 |
tgtccgaaacaaaggataaacatcaatcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcaga |
40870478 |
T |
|
| Q |
201 |
aacgctttttcctcgtttggactatt |
226 |
Q |
| |
|
|| | ||||||||||| ||||||||| |
|
|
| T |
40870477 |
aatgatttttcctcgtatggactatt |
40870452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 126 - 215
Target Start/End: Complemental strand, 40352777 - 40352688
Alignment:
| Q |
126 |
atcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcagaaacgctttttcctcg |
215 |
Q |
| |
|
||||||||| || || |||||||| |||||||||||||||||||| || || ||| ||||||||| ||||| |||||| |||||||||| |
|
|
| T |
40352777 |
atcttttgcaaagactttgacacagtctgatgcaaacaatggtggagggttctctgttcctagatactgtgctgaaacgatttttcctcg |
40352688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 142 - 221
Target Start/End: Original strand, 28346744 - 28346823
Alignment:
| Q |
142 |
ttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcagaaacgctttttcctcgtttgga |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||| || |||||| |||||| |||||||| || ||| |||| ||||||||||| |
|
|
| T |
28346744 |
ttgactcaatctgatgctaacaatggtggaggtttttctgttcctaggtattgtgccgagacgattttccctcgtttgga |
28346823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 127 - 226
Target Start/End: Original strand, 42730140 - 42730239
Alignment:
| Q |
127 |
tcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttcttgtcctagatattgtgcagaaacgctttttcctcgtttggactatt |
226 |
Q |
| |
|
|||||||| || || || |||||||||||||||||||| ||||| || |||||| ||||||||| ||||| || || |||||||| | ||||| |||| |
|
|
| T |
42730140 |
tcttttgcaaagacattaacacaatctgatgcaaacaacggtggaggtttttctgttcctagatactgtgctgagactatttttcctaggttggattatt |
42730239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 126 - 180
Target Start/End: Original strand, 21715642 - 21715696
Alignment:
| Q |
126 |
atcttttgcgaaaaccttgacacaatctgatgcaaacaatggtggtggcttttct |
180 |
Q |
| |
|
||||||||| || || ||||| ||||||||||||||||||||||| || |||||| |
|
|
| T |
21715642 |
atcttttgctaagactttgactcaatctgatgcaaacaatggtggggggttttct |
21715696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University