View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_447 (Length: 245)
Name: NF10481A_low_447
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_447 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 6412972 - 6413197
Alignment:
| Q |
17 |
ataaacgaggtttggtttgaacttttatcatatcgtcggatctagtaaataccaaaatttggaagaaaaattattaattcatttccccaaaagaaaattc |
116 |
Q |
| |
|
|||||| || || ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6412972 |
ataaacaagtttgggtttgaaccattatcatatcgtccgatctagtaaataccaaaatttggaagaaaaattattaattcatt-ccccaaaagaaaattc |
6413070 |
T |
|
| Q |
117 |
ccttactaaccccaaattaaataataatatgaactggaatatactaaaaaataggtgtcacactcttcattgtaatttccctcttctcctttctttctta |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6413071 |
ccttactaaccccaaattaaataataatatgaactggaatatactaaaaaataggtgtcacactcttcattgtaatttccctctactcctttctttctta |
6413170 |
T |
|
| Q |
217 |
accgtcctcgccacgttcatatcagtc |
243 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
6413171 |
accgtcctcgccacgttcatagcagtc |
6413197 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University