View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_448 (Length: 245)
Name: NF10481A_low_448
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_448 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 17 - 179
Target Start/End: Complemental strand, 54909444 - 54909282
Alignment:
| Q |
17 |
gacagcaatacttacgactttgcaccaaaataatttagatttccactgaccactgtaatgttaaattatcattgcttggatggatgctgcttatgttcct |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909444 |
gacatcaatacttacgactttgcaccaaaataatttagatttccactgaccactgtaatgttaaattatcattgcttggatggatgctgcttatgttcct |
54909345 |
T |
 |
| Q |
117 |
ctttagcttgtggcttattttcaatccaagcttcaccatgctagattataatcacgagtatgc |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54909344 |
ctttagcttgtggcttattttcaatccaagcttcaccatgctagattataatcacgagtatgc |
54909282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University