View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_455 (Length: 244)
Name: NF10481A_low_455
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_455 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 25 - 225
Target Start/End: Original strand, 3790141 - 3790340
Alignment:
| Q |
25 |
tctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcgcccttcccctcgtatgtgtctatgagtagtcatactcaacaaattaat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3790141 |
tctaaagttgaagggagcttcgcaatgccatgctagatgatcaccttcctcttccttcccctcttatgtgtctatgagtagtcatactcaacaaattaat |
3790240 |
T |
 |
| Q |
125 |
tgaaaacaaattagaataatcataagcgagataagttttaattgagatgatgagtttannnnnnnncttgttgagaaatatgactatttgctcctattcc |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3790241 |
tgaaaacaaattagaataatcataagcgagataagttctaattgagatgatgagttta-ttttttccttgttgagaaatatgactatttgctcctattcc |
3790339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University