View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_461 (Length: 243)
Name: NF10481A_low_461
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_461 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 6e-18; HSPs: 11)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 9101091 - 9101045
Alignment:
| Q |
142 |
gtgggagatatgagaattgagagggtgtgggagtatttataagggag |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9101091 |
gtgggagatatgagaattgagagggtgtgggagtatttataagggag |
9101045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9101226 - 9101182
Alignment:
| Q |
1 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatagc |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9101226 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatagc |
9101182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 185 - 224
Target Start/End: Complemental strand, 9100998 - 9100959
Alignment:
| Q |
185 |
ggagcttgtgaaaatatattatgaatgatttggtcgttag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9100998 |
ggagcttgtgaaaatatattatgaatgatttggtcgttag |
9100959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9026152 - 9026108
Alignment:
| Q |
1 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatagc |
45 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
9026152 |
ggcggcgaagatgatgaccaaaaagaaggagaagaacttcatagc |
9026108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 9026020 - 9025981
Alignment:
| Q |
148 |
gatatgagaattgagagggtgtgggagtatttataaggga |
187 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9026020 |
gatatgagaattgagagggtgtgagagtatttataaggga |
9025981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 44
Target Start/End: Complemental strand, 9029111 - 9029068
Alignment:
| Q |
1 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatag |
44 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
9029111 |
ggcggcgaagatgatgaccaaaaagaaggagaagaacttcatag |
9029068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 9034485 - 9034446
Alignment:
| Q |
148 |
gatatgagaattgagagggtgtgggagtatttataaggga |
187 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9034485 |
gatatgagaattgagagggtgtgagagtatttataaggga |
9034446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9023448 - 9023404
Alignment:
| Q |
1 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatagc |
45 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
9023448 |
ggcggcgaagatgatgaccaaaaagaaggagaagaactttatagc |
9023404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 148 - 187
Target Start/End: Complemental strand, 9023316 - 9023277
Alignment:
| Q |
148 |
gatatgagaattgagagggtgtgggagtatttataaggga |
187 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9023316 |
gatatgagaattgagagggtgtgaaagtatttataaggga |
9023277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 142 - 186
Target Start/End: Complemental strand, 8746839 - 8746795
Alignment:
| Q |
142 |
gtgggagatatgagaattgagagggtgtgggagtatttataaggg |
186 |
Q |
| |
|
||||| ||||||||||||||||| || ||| |||||||||||||| |
|
|
| T |
8746839 |
gtgggtgatatgagaattgagagagtttggaagtatttataaggg |
8746795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 8746952 - 8746908
Alignment:
| Q |
1 |
ggcggcgaagatgatgaccataaagaaggggaagaacttcatagc |
45 |
Q |
| |
|
|||||||||||||| ||| | |||||||| ||||||||||||||| |
|
|
| T |
8746952 |
ggcggcgaagatgaagacgaaaaagaaggagaagaacttcatagc |
8746908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University