View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_462 (Length: 243)
Name: NF10481A_low_462
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_462 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 32582702 - 32582469
Alignment:
| Q |
4 |
gcagaaacatagaaactgaagcaaaaagaagaagagattcagagaatggagaaacaaaatctaatgcttcaagaaaaagcgaaaacactgattatggaga |
103 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582702 |
gcagtaacaaagaaactgaagcaaaaagaagaagagattcagagaatggagaaacaaaatctaatgcttcaagaaaaagcgaaaacactgattatggaga |
32582603 |
T |
|
| Q |
104 |
atcagatttggagagaaatggctttgactaacgaatctgctgtaaacacgttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582602 |
atcagatttggagagaaatggctttgacaaacgaatctgctgtaaacacgttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaa |
32582503 |
T |
|
| Q |
204 |
cgatgaagatgcagcgtcgatttgtggaagtaac |
237 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||| |
|
|
| T |
32582502 |
cgatgacgatgcagcgtcgagttgtggaagtaac |
32582469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University