View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_463 (Length: 243)
Name: NF10481A_low_463
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_463 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 12 - 221
Target Start/End: Original strand, 7430820 - 7431022
Alignment:
| Q |
12 |
tggacatcaaaaccaatctttcatctaatgcaaaagtaagctagctattcaagcaaacacaatttcaaaacgatcaccttcacagtaatcaaaacaaaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7430820 |
tggacatcaaaaccaatctttcatctaatgcaaaagtaagctagctattcaagcaaacacaatttcaaaacgatcaccttcacactattcaaaacaaaat |
7430919 |
T |
 |
| Q |
112 |
caagttctatataacccatatagcaccaaccaccaagacttcacatacagttacattcaatattacatgttttaatactattaccggtgtcaacatgtcc |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430920 |
caagttctatataacccatatag-------caccaagacttcacatccagttacattcaatattacatgttttaatactattaccggtgtcaacatgtcc |
7431012 |
T |
 |
| Q |
212 |
ggtgtctgtg |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
7431013 |
ggtgtctgtg |
7431022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University