View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_467 (Length: 242)
Name: NF10481A_low_467
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_467 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 29424294 - 29424069
Alignment:
| Q |
1 |
aatgggggagcaactttttcgaagacccggagatccatccctagatgaactcattcagaagcataatagtgagaaagacaaagcagataacgctagtcaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29424294 |
aatgggggagcaactttttcaaagacccggagatccatccctagatgaactcattcagaagcataatagtgagaaagacaaagcagataacgctagtcaa |
29424195 |
T |
|
| Q |
101 |
gaggaagttgatggaaattcgaaaacagaattgtagttaaacggtacaggtatattcctccagacgttgagataaagcaattgtatcacnnnnnnnaaat |
200 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29424194 |
gaggaagttgatggaaattcaaaaacagaattgtagttaaacggtacaggtatattcctccagacgttgagataaagcaattgtatcactttttttaaat |
29424095 |
T |
|
| Q |
201 |
ggatttctcccactgttattattttt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29424094 |
ggatttctcccactgttattattttt |
29424069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University