View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_474 (Length: 241)
Name: NF10481A_low_474
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_474 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 1226747 - 1226533
Alignment:
| Q |
19 |
ctatgatgatatctttggattatctctttgaagtctagtatctactttcatggtgtctttttaaatgccataaatgatgattgtgaactccatacatcat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
1226747 |
ctatgatgatatctttggattatctctttgaagtctagtatctgctttcatggtctctttttaaatgccagaaatgatgattgtgaact-------tcat |
1226655 |
T |
|
| Q |
119 |
acatgcacatgccgcatgtgacatgcgtataatatatagttaggtaaccttattattttgatctgaacaattcaatagagttcaattagatcaagatttc |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1226654 |
acatgcacatgccgcatgtgacatgc-tataatatatagttaggtaaccttattattttgatctgaacaattcaatagagttcaattagatcaagatttc |
1226556 |
T |
|
| Q |
219 |
atcctcttgttctttgcaaaaat |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1226555 |
atcctcttgttctttgcaaaaat |
1226533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 99 - 202
Target Start/End: Complemental strand, 41965240 - 41965137
Alignment:
| Q |
99 |
ttgtgaactccatacatcatacatgcacatgccgcatgtgacatgcgtataatatatagttaggtaaccttattattttgatctgaacaattcaatagag |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41965240 |
ttgtgaactccatacatcatacatgcacatgccgcatgtgacatgcgtataatatatagttaggtaaccttattattttgatctgaacaattcaatagag |
41965141 |
T |
|
| Q |
199 |
ttca |
202 |
Q |
| |
|
|||| |
|
|
| T |
41965140 |
ttca |
41965137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 43 - 99
Target Start/End: Complemental strand, 41965347 - 41965291
Alignment:
| Q |
43 |
tctttgaagtctagtatctactttcatggtgtctttttaaatgccataaatgatgat |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
41965347 |
tctttgaagtctagtatctactttcatgatctctttttaaatgccagaaatgatgat |
41965291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University