View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_483 (Length: 241)
Name: NF10481A_low_483
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_483 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 224
Target Start/End: Complemental strand, 42744073 - 42743859
Alignment:
| Q |
10 |
gaaatgaagggaacatagagtggtttacacagaacactggctttatgtttgagcaagcaccttacttcaatgcccttttggtttttattgaggtaaactt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42744073 |
gaaatgaagggaacatagagtggtttacacaaaacactggctttatgtttgagcaagcaccttatttcaatgcccttttggtttttattgaggtaaactt |
42743974 |
T |
|
| Q |
110 |
tattgtcttggattctctacctcttctgcattgtctttttgtctcatatcctagaaaacattttagtacatgtctggattaacggtgaaattgacaacaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42743973 |
tattgtcttggattctctacctcttctgcattgtctttttgtctcatatcctagacaacattttagtacatgtctggattaacgttgaaattgacaacaa |
42743874 |
T |
|
| Q |
210 |
aatcgcagttgattt |
224 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42743873 |
aatcgcagttgattt |
42743859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 42748797 - 42748704
Alignment:
| Q |
10 |
gaaatgaagggaacatagagtggtttacacagaacactggctttatgtttgagcaagcaccttacttcaatgcccttttggtttttattgaggt |
103 |
Q |
| |
|
||||||||||| ||||| | ||||| |||| ||||||||||||||||| || |||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
42748797 |
gaaatgaaggggacatacaatggttcgcacaaaacactggctttatgttcgaaatagcaccctatttcaatgccattttggtttttattgaggt |
42748704 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University