View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_484 (Length: 241)
Name: NF10481A_low_484
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_484 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 8205380 - 8205171
Alignment:
| Q |
20 |
gatgggttgattgggttggatgattttgtgaagttcgtagagggagggaaagaggaagggaaagtaaatgacccaagagaggcttttaagatgtatgaaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8205380 |
gatgggttgattgggttggatgattttgtgaagtttgtagagggagggaaagaggaagagaaagtaaatgacctaagagaggcttttaagatgtatgaaa |
8205281 |
T |
|
| Q |
120 |
tggagggatgtggttgcatcacaccaaagagtctaaagagaatgcttggaagattgggggagtgtagaagtatagatgagtgtcaagctatgatttctca |
219 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
8205280 |
tggaaggatgtggttgcatcacaccaaagagtctaaagagaatgcttggaagattgggtgagtgtagaagtgtagatgaatgtcaagctatgatttctca |
8205181 |
T |
|
| Q |
220 |
atttgatatt |
229 |
Q |
| |
|
|||||||||| |
|
|
| T |
8205180 |
atttgatatt |
8205171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University