View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_495 (Length: 239)
Name: NF10481A_low_495
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_495 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 46984751 - 46984524
Alignment:
| Q |
11 |
catcgcacaaatgaagatgtcggtcttgctattggaacggtactgccaacagctaagtgagctgtttatttcttttctttttggctctacttattacagc |
110 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46984751 |
catcacacaaatgaagatgtcgctcttgctattggaacggtactgccaacagctaagtgagctgtttatttcttttctttttggctctacttattacagc |
46984652 |
T |
|
| Q |
111 |
tgttcctggaatg------atgtttaaagattggtgtgaagttaaatctttgcattggacttcatcctttctatgcaaaatgcaatttaactaattgacc |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46984651 |
tgttcctggaatgttaaacatgtttaaagattggtgtgaagttaaatctttgcattggacttcatcctttctatgcaaaatgcaatttaactaattgacc |
46984552 |
T |
|
| Q |
205 |
ataacgactctaacattgagtataatct |
232 |
Q |
| |
|
||||||||||||||||||| |||||||| |
|
|
| T |
46984551 |
ataacgactctaacattgattataatct |
46984524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University