View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_502 (Length: 238)
Name: NF10481A_low_502
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_502 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 9 - 196
Target Start/End: Original strand, 33817434 - 33817621
Alignment:
| Q |
9 |
ataatactagtggtatttactcgaataacttgacttattggactttctcggcaaatctacctttctcgatggatcaactccatatcatttctaaggtttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33817434 |
ataatactagtggtatttactcgaataacttgacttattggactctctcggcaaatctatctttctcgatggatcaactccaaatcatttctaaggtttg |
33817533 |
T |
 |
| Q |
109 |
gaagagtgttaatccggaaaaagatatcgcattttcttggaaactgctcctcgacaaggtcccgactcatcaaagtcttatgttgtcc |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33817534 |
gaagagtgttaatccggaaaaagttatcgcattttcttgaaaactgctcctcgacaaggccccgactcatcaaagtcttatgttgtcc |
33817621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University