View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_510 (Length: 237)

Name: NF10481A_low_510
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_510
NF10481A_low_510
[»] chr1 (1 HSPs)
chr1 (51-104)||(21695315-21695368)


Alignment Details
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 51 - 104
Target Start/End: Original strand, 21695315 - 21695368
Alignment:
51 tgtgtcaatatttttcatttcgaattagatgacaagaaaaatgatatagaagag 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21695315 tgtgtcaatatttttcatttcgaattagatgacaagaaaaatgatatagaagag 21695368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University