View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_514 (Length: 236)
Name: NF10481A_low_514
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_514 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 24892868 - 24892670
Alignment:
| Q |
16 |
atgaacctatgatttgcgatgttccaacgaagaatgaatttttgaaataaaggatgtttgaggtagagcatgaagtgactgctgacaccgccaacattaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24892868 |
atgaacctatgatttgcgatgttccaatgaagaatgaatttttgaaataaaggacgtttgaggtagagcatgaagtgactgctgacactgccaacattaa |
24892769 |
T |
 |
| Q |
116 |
aatttaaaaatgactgagatactatgttgtgaaaatattttgtctgttagtttgtgttaggttgactgagtcagagactctgatattcaatgtaaacac |
214 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24892768 |
aatttaaaaatgactgagatgctatgttgtgaaaatattttgtctgtgagtttgtgttaggttgactgagtcagagactctgatattcaatgtaaacac |
24892670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University