View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_521 (Length: 236)
Name: NF10481A_low_521
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_521 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 17 - 226
Target Start/End: Original strand, 2849465 - 2849674
Alignment:
| Q |
17 |
tgttgatgttattaatgcgttgataactatgtatgcgaaatgtggggatattgatactgctaggttggtttttgataagatgcctaaaaaagataggatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2849465 |
tgttgatgttattaatgcgttgataactatgtatgcgaaatgtggggatattgatactgctaggttggtttttgataagatgcctaaaaaagataggatt |
2849564 |
T |
 |
| Q |
117 |
tcgtggaatgcgatgattgctgggtgttttgagaatggtgaatgtttggaggggttgacattgttttgcaggatgattgaatatccggttgaccacgatt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2849565 |
tcgtggaatgcgatgattgctgggtgttttgagaatggtgaatgtttggaggggttgacattgttttgcaggatgattgaatatccggttgacccagatt |
2849664 |
T |
 |
| Q |
217 |
tgatgtccat |
226 |
Q |
| |
|
||||| |||| |
|
|
| T |
2849665 |
tgatgaccat |
2849674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University