View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_528 (Length: 234)
Name: NF10481A_low_528
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_528 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 214
Target Start/End: Complemental strand, 3429506 - 3429300
Alignment:
| Q |
8 |
aaacagagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactcca |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3429506 |
aaacaaagaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccgcaactattactccctccttatggcacactcca |
3429407 |
T |
|
| Q |
108 |
atcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaacc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429406 |
atcccatatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaacc |
3429307 |
T |
|
| Q |
208 |
aagatgg |
214 |
Q |
| |
|
||||||| |
|
|
| T |
3429306 |
aagatgg |
3429300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 3426021 - 3425822
Alignment:
| Q |
14 |
agaagacaaaatgaggactatacccaccacaatgctaaacacacaccccaacaacacccccacaactattactccctccttatggcacactccaatccca |
113 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||||||| |||| |||||| ||||||||| ||| ||||||||||||||||||||| ||| |
|
|
| T |
3426021 |
agaagacaaaatgaggagtatacccaccaaattgctaaacacacaccctaacatcaccccaacaactattcctcactccttatggcacactccaatgcca |
3425922 |
T |
|
| Q |
114 |
tatctctttggaggactagcagccattatgggactcatagccttggcgttgttggcactagcatgctctttttgtaaactctcaaggaacaaccaagatg |
213 |
Q |
| |
|
|||||||||||||||||||| || ||||| || ||||||||||||||||| |||| |||||||||||| | ||||| |||||||||| |||||||||||| |
|
|
| T |
3425921 |
tatctctttggaggactagctgctattataggtctcatagccttggcgttattggtactagcatgctcatattgtagactctcaagggacaaccaagatg |
3425822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University