View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_530 (Length: 234)
Name: NF10481A_low_530
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_530 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 23 - 208
Target Start/End: Complemental strand, 33650050 - 33649866
Alignment:
| Q |
23 |
ggaagaggcaattagagcttaaaattgaattagtcattgttagacccaccaagatatgaaatttaacagttggatcaaaatcggacgctaacgattttaa |
122 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33650050 |
ggaagatgcaattagagcttaaaattgaagtagtcattgttagacccaccaagatatgaaatttaaccgttggatcaaaatcggacgctaacgattttaa |
33649951 |
T |
|
| Q |
123 |
actcggtattttagnnnnnnnnnnnctttaaataatcaaatcatgtattgaaatttggatctatcaatctcatatccaaatattgt |
208 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33649950 |
actcggtattttag-ttttttttttctttaaataatcaaatcatgtattgaaatttggatctatcaatctcatatccaaatattgt |
33649866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University