View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_532 (Length: 234)
Name: NF10481A_low_532
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_532 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 219
Target Start/End: Complemental strand, 8061995 - 8061794
Alignment:
| Q |
18 |
aatatgtggaagggactagtagactttttgtttttgtttgatccaatataattatttggttaaggtgtctatattgtgatcttgcatttaaatggcacac |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8061995 |
aatatgtggaagggactaatagactttttgtttttgtttgatccaatataattatttggttaaggtgtctatattgtgatcttgcatttaaatggcacac |
8061896 |
T |
|
| Q |
118 |
ttgagtaattgatgttgcctaatgttaatactgtggtgtaaaaccctagttcttgagttagggtttggtttagaactttcaacattttgtttgtaattga |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8061895 |
ttgagtaattgatgttgcctaatgttaatactgtggtgtaaaaccctagttcttgagttagggtttggtttagaactttcaacattttgtttgaaattga |
8061796 |
T |
|
| Q |
218 |
tg |
219 |
Q |
| |
|
|| |
|
|
| T |
8061795 |
tg |
8061794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University