View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_534 (Length: 234)
Name: NF10481A_low_534
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_534 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 39896939 - 39896721
Alignment:
| Q |
1 |
atattcaaattaagtcaccgcctcaaaaagttttcttcttggttttatgattgtaacaccctttcctttttatgaatgtatatatgatatatttttggaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39896939 |
atattcaaattaagtcaccgcctcaaaaagttttcttcttggttttacgattgtaacaccctttcctttttatgaatgtatatatgatatatttttggaa |
39896840 |
T |
|
| Q |
101 |
aatggtttaagagtgtatgaaatgcggaaaacatgtgaaaatttgttttactattgttgctgccttcctaggggcagctatccccgactcagttcatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39896839 |
aatggtttaagagtgtatgaaatgtggaaaacatgtgaaaatttgttttactattgttgctgccttcctaggggcagctatccccgactcagttcatgaa |
39896740 |
T |
|
| Q |
201 |
gttagtgcctagtgatgtc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39896739 |
gttagtgcctagtgatgtc |
39896721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University