View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_539 (Length: 233)

Name: NF10481A_low_539
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_539
NF10481A_low_539
[»] chr4 (1 HSPs)
chr4 (22-215)||(2442696-2442889)
[»] chr1 (1 HSPs)
chr1 (59-191)||(50984196-50984328)
[»] chr8 (1 HSPs)
chr8 (35-71)||(34019916-34019952)


Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 22 - 215
Target Start/End: Original strand, 2442696 - 2442889
Alignment:
22 gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggt 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || || |  |||||||||||||    
2442696 gaccgaactctagcttctctttttgcaaccattttcagactatcttgctctgcgtgcgatagaatgatacaaaatttgtataaattgattgtaaaatggt 2442795  T
122 aatatagaggagccctcgatcaatttctggtaaacagtgtcagtgagatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt 215  Q
    |||||| || |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
2442796 aatataaagaagccctcgatcaatttctggtaaacagtgttagtgtgatgaacttgaaacaaaaacaaggttaacaaactcatatacaaatatt 2442889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 59 - 191
Target Start/End: Complemental strand, 50984328 - 50984196
Alignment:
59 gactatcttgctctgcatgcgatagaatgatacaaaatttctagaattgcattgtaaaatggtaatatagaggagccctcgatcaatttctggtaa--ac 156  Q
    ||||||||||||||||||| || ||| | | ||||||||| |||||||| |||| ||||||||||||||||| ||||||| |||||||||| | ||  ||    
50984328 gactatcttgctctgcatgtgacagattaaaacaaaatttgtagaattg-attg-aaaatggtaatatagagaagccctcaatcaatttctagaaaacac 50984231  T
157 agtgtcagtgagatgaacttgaaacaaaaacaagg 191  Q
    ||| ||||||||||||| ||||||||||| |||||    
50984230 agtttcagtgagatgaagttgaaacaaaatcaagg 50984196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 35 - 71
Target Start/End: Complemental strand, 34019952 - 34019916
Alignment:
35 cttctctttttgcaaccattttcagactatcttgctc 71  Q
    |||||||||||||||||||||||||||||||||||||    
34019952 cttctctttttgcaaccattttcagactatcttgctc 34019916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University