View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_541 (Length: 232)
Name: NF10481A_low_541
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_541 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 2 - 226
Target Start/End: Complemental strand, 47886212 - 47885989
Alignment:
| Q |
2 |
ggacgttggtgtaaactagtttacattgattatgattgtcccttttctcttattatattatcatacacaattcnnnnnnngaaaaaatatatcatacaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
47886212 |
ggacgttggtgtaaactagtttacatcgattatgattgtcccttttctcttattatat-atcatacacaattctttttttgaaaaaatatatcatacaca |
47886114 |
T |
 |
| Q |
102 |
gttctaaagttaaatatctcttattttttggttacaagttaaatatctcttatatatgaacataatattttacattgtaactttttgtctgtttctcatt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47886113 |
gttctaaagttaaatatctcttattttttggttacaagttaaatatctcttatatatgaacataatattttacattgtaactttttgtctgtttctcatt |
47886014 |
T |
 |
| Q |
202 |
tctaacatttgtgacttgatgctct |
226 |
Q |
| |
|
|| |||||||||||||||||||||| |
|
|
| T |
47886013 |
tcaaacatttgtgacttgatgctct |
47885989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University