View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_542 (Length: 232)
Name: NF10481A_low_542
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_542 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 34092606 - 34092375
Alignment:
| Q |
1 |
gagcaattataattaatttaaaaaatcttttattgtaggcttgttaaagannnnnnnaaaaccaatattgatgttttaattaaatttgaaagatattttn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34092606 |
gagcaattataattaatttaaaaaatcttttattgtaggcttgttaaagatttttttaaaaccaattttgatgttttaattaaatttgaaagatatttta |
34092507 |
T |
|
| Q |
101 |
nnnnnncgatgttatgttaaagatgaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatg |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092506 |
aaaaaacgatgttatgttaaagattaaataaatattttgattaaccttgtattaaataatttttggtagaaaaaatagaaaacttagtctgtatatgatg |
34092407 |
T |
|
| Q |
201 |
tgatttgttttcaaaggagattgtatatgatg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34092406 |
tgatttgttttcaaaggagattgtatatgatg |
34092375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University