View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_543 (Length: 232)
Name: NF10481A_low_543
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_543 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 379431 - 379651
Alignment:
| Q |
1 |
agttgaatgagcgtgatgcccaccagccgcatgtggcggcggagtggggtacggatgtaatgatgatgagtcgttgtggtctatgaggaggagccacaac |
100 |
Q |
| |
|
|||||||||||| ||| ||||||||| ||||||| ||||||| || |||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
379431 |
agttgaatgagcttgaaccccaccagcaccatgtggaggcggaggaggcgacggatgtcatgatgatgagtcgttgtggtctaggaggaggagccacaac |
379530 |
T |
|
| Q |
101 |
caatggatcaatattgtggtggtccgtatgatgtgtttgttctcacctaccatcatcaagagattaacacattgccatattcaacacttgcaattcaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
379531 |
caatggatcaatattgtggtggtccgtatgatgtgtttgtgctcacctaccatcatcaagagattaacacattgccatattcaacacttgcaattcgaat |
379630 |
T |
|
| Q |
201 |
ctcatatttcaatatattcat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
379631 |
ctcatatttcaatatattcat |
379651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University