View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_546 (Length: 231)
Name: NF10481A_low_546
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_546 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 138 - 221
Target Start/End: Complemental strand, 7617833 - 7617750
Alignment:
| Q |
138 |
ttatatctgagtcagacatggtgcttaaccttaaaaattgtctggtcttaatttatgtttgtactttgttgttcaaagcaaaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617833 |
ttatatctgagtcagacatggtgcttaaccttaaaaattgtctggtcttaatttatgtttgtactttgttgttcaaagcaaaac |
7617750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 7 - 80
Target Start/End: Complemental strand, 7617964 - 7617891
Alignment:
| Q |
7 |
aatagtttctccaatgaaaggccaacccattcttcctggtggaagattaaggttgggtttggcttgttttgttt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617964 |
aatagtttctccaatgaaaggccaacccattcttcctggtggaagattaaggttgggtttggcttgttttgttt |
7617891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University