View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_550 (Length: 231)
Name: NF10481A_low_550
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_550 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 23 - 222
Target Start/End: Complemental strand, 10006593 - 10006394
Alignment:
| Q |
23 |
aggaaagagagatatgtgctaacctcccattcttgtgaggaacgacagcagcatgttggcgagagacggattgatgatcaagcacaaaatcacaagtctg |
122 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
10006593 |
aggagagagagatatgttctaacctgccattcttgtgaggaacgacagcagcatgttggcgagagacggattgatgatcgagcacaaaatcacaagtctg |
10006494 |
T |
 |
| Q |
123 |
gatttgcctcccaaaaatttttctccgtctatccaaattaatccgatctagcacctgaccatccttcataacttccaagtaaaaaacaccagcccgcggc |
222 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
10006493 |
gatttgcctcccaaaaatatttctccgtctatccaaattaatccgatctagcacctgaccatccttcataacttccaagtaaaaaacacccggccgcggc |
10006394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University