View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_564 (Length: 230)
Name: NF10481A_low_564
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_564 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 401676 - 401449
Alignment:
| Q |
1 |
atttgggcttttaattcccttcctctgactttgtgatgctttttggcaggtttggcaggcacttttggctgttagaacacttgtgctgccaccagctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401676 |
atttgggcttttaattcccttcctctgactttgtgatgctttttggcaggtttggcaggcacttttggctgttagaacacttgtgctgccaccagctgaa |
401577 |
T |
|
| Q |
101 |
gacattgaaacatggctcaattttgcttctctttgcagaaaaagtgggcgcattagccaagcaagatctactttagttaaacttctacaggtttgaactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
401576 |
gacattgaaacatggctcaattttgcttctctttgcagaaaaagtgggcgcattagccaagcaagatctactttagttaaacttctacaggtttgaactg |
401477 |
T |
|
| Q |
201 |
tgcacctggtctatgatggtttctttct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
401476 |
tgcacctggtctatgatggtttctttct |
401449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University