View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_571 (Length: 230)
Name: NF10481A_low_571
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_571 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 6 - 230
Target Start/End: Original strand, 29563196 - 29563420
Alignment:
| Q |
6 |
acatcagttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgaacttagc |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
29563196 |
acatcacttctaaaattttaaaatttccacaggtttcttatatttcccaaaactggcctgttcaatatgtggcagctagtcaggatggaatgtacttggc |
29563295 |
T |
|
| Q |
106 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggtgatgttacccaggaccaaaagattcagtgtaagggc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29563296 |
ggttgctggtcttcatggtttgatattgtatgatatacgaatgaaaagatggagagtctttggagatgttacccaggaacaaaagattcagtgtaagggc |
29563395 |
T |
|
| Q |
206 |
ttgctatggctgggaaagattgtcg |
230 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29563396 |
ttgctatggctgggaaagattgtcg |
29563420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University