View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_583 (Length: 230)
Name: NF10481A_low_583
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_583 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 158 - 225
Target Start/End: Complemental strand, 6412756 - 6412689
Alignment:
| Q |
158 |
agttcgaactcttctattcctcatggtgaagatgaatatacaattttctcctacattaagtggttatt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6412756 |
agttcgaactcttctattcctcatggtgaagatgaatacacaattttctcctacattaagtggttatt |
6412689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University