View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_604 (Length: 228)
Name: NF10481A_low_604
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_604 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 9769590 - 9769817
Alignment:
| Q |
1 |
ttttgggagaaaagttgaaagcggaagtgtgatgacgatgaagaagaagatgagtagtagaactcgtgcgctaagaggtagtttcgatcattcaatgcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9769590 |
ttttgggagaaaagttgaaagcggaagtgtgatgacgatgaagaagaagatgagtagtagaactcgtgcgctaagaggtagtttcgatcattcaatgcct |
9769689 |
T |
 |
| Q |
101 |
ttggctgttctttagcaatcgagttagttggagggtttaaattgctgttacaatcgcgattaagattatgtcgtgatctttggtattacagagaattgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9769690 |
ttggctgttctttagcaatcgagttagttggagggtttaaattgctgttacaatcgcgattaagattatgtcgtgatctttggtattacagagaattgca |
9769789 |
T |
 |
| Q |
201 |
gataaatacgatttatgtggttgtctga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9769790 |
gataaatacgatttatgtggttgtctga |
9769817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University