View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_606 (Length: 228)
Name: NF10481A_low_606
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_606 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 200
Target Start/End: Original strand, 55654463 - 55654648
Alignment:
| Q |
14 |
gaaaaatatcaaacacactcttgtatatattgaccaatttgaatccgctataagattaatttttgagttaacgatcgctaatactatatcttccaaatgt |
113 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
55654463 |
gaaaaatatcaaacacactctcgtatatattgaccaatttaaatccactataagattaatttttaagttaacgatcgttag-actatatcttccaaatgt |
55654561 |
T |
 |
| Q |
114 |
gcgactccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55654562 |
gcgactccatgaattgaacctagattgtttttctaagtaaagtgatgttgccaactctaccatcatcatattggtgacgtgatctta |
55654648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University