View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_615 (Length: 227)
Name: NF10481A_low_615
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_615 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 55 - 215
Target Start/End: Original strand, 467430 - 467590
Alignment:
| Q |
55 |
tataaaaacagctttggcagtattaattgggaatccaaagtatcactgttgtagcaaataaggtaaatggttaaaagtgtgaggtggtgaagaaaaggga |
154 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
467430 |
tataaaaacagctatggcagtattaattgggaatccaaagtatcactgttgtagcaaataaggtaaatggttaaaagtgtgaggtggtgaagaaaaggga |
467529 |
T |
|
| Q |
155 |
agaatgattgggcaatgaacagtgtggtatgaaattgactgctcaagtcaacaccaaagtc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
467530 |
agaatgattgggcaatgaacagtgtggtatgaaattgactgttcaagtcaacaccaaagtc |
467590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 467061 - 467109
Alignment:
| Q |
15 |
gacatcagaaataaacttttcatactgaaaatttgagctatataaaaac |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
467061 |
gacatcagaaataaacttttcatactgaaaatttgagctatataaaaac |
467109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University