View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_617 (Length: 226)
Name: NF10481A_low_617
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_617 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 45 - 226
Target Start/End: Original strand, 33102087 - 33102268
Alignment:
| Q |
45 |
atgccatgaactataggttcatcgcagctgatacacttcaaaaaatcatcatgctccttgcacttacaatttggactaatttcacagctaatggtagctt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102087 |
atgccatgaactataggttcatcgcagctgatacacttcaaaaaatcatcatgctccttgcacttacaatttggactaatttcacagctaatggtagctt |
33102186 |
T |
|
| Q |
145 |
agagtggatgatcacaatcttctctctttcaacattacccaacactttggttatgggaattccacttctcatagctatgtat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102187 |
agagtggatgatcacaatcttctctctttcaacattacccaacactttggttatgggaattccacttctcatagctatgtat |
33102268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 50 - 207
Target Start/End: Complemental strand, 10838990 - 10838833
Alignment:
| Q |
50 |
atgaactataggttcatcgcagctgatacacttcaaaaaatcatcatgctccttgcacttacaatttggactaatttcacagctaatggtagcttagagt |
149 |
Q |
| |
|
||||||| |||||||| || || || ||||||||||||||||||||||| | |||||| || | ||||| ||||| ||||| | ||||| | |
|
|
| T |
10838990 |
atgaacttcaggttcatagctgcagacacacttcaaaaaatcatcatgctagtagcactttcattatggacattgttcactaaaaatggcaatttagaat |
10838891 |
T |
|
| Q |
150 |
ggatgatcacaatcttctctctttcaacattacccaacactttggttatgggaattcc |
207 |
Q |
| |
|
||||||| |||||||| || | |||||| | || ||||||||||||||||||||||| |
|
|
| T |
10838890 |
ggatgataacaatcttttcattatcaacacttcctaacactttggttatgggaattcc |
10838833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University