View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_622 (Length: 226)
Name: NF10481A_low_622
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_622 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 173 - 226
Target Start/End: Complemental strand, 14722044 - 14721991
Alignment:
| Q |
173 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttga |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14722044 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttga |
14721991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 173 - 225
Target Start/End: Original strand, 39465207 - 39465259
Alignment:
| Q |
173 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg |
225 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39465207 |
tgtaaagtaatgttcatatatggtcagatttagtggagttagcaaaaatgttg |
39465259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University