View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_624 (Length: 226)
Name: NF10481A_low_624
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_624 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 2196037 - 2196262
Alignment:
| Q |
1 |
atagcaattctggtttaataactgaccactgagaatcacagggttattaacagatagattgcctcgtaaatttaccttcacagtctcactcgagaaagat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2196037 |
atagcaattctggtttaataactgaccactgagaatcacagggttattaacagatagattgcctcgtaaatttaccttcacagtctcacttgagaaagat |
2196136 |
T |
|
| Q |
101 |
ttatcaagagcaagggtaagtacccgaccctccaaatgccaatcagatatgcaggtcattatggtttggtttagggaatcacctgaatcaggaaatggta |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2196137 |
ttatcaagtgcaagggtaagtacccgaccctccaaatgccaatcagatatgcaggtcattatggtttggtttagggaatcacctgaatcaggaaatggta |
2196236 |
T |
|
| Q |
201 |
ctttaacaacattgagaataggatga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2196237 |
ctttaacaacattgagaataggatga |
2196262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University