View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_631 (Length: 225)
Name: NF10481A_low_631
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_631 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 206
Target Start/End: Complemental strand, 36474414 - 36474227
Alignment:
| Q |
19 |
atgattcctggtggagcaggagcaactgttttatacaacttgaagaaaagacatccaacacttgacctgcctgtgattgactatgatttagcacttcttt |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474414 |
atgattactggtggagcaggagcaactgttttatacaacttgaagaaaagacacccaacacttgacctgcctgtgattgactatgatttagcacttcttt |
36474315 |
T |
|
| Q |
119 |
ttcaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttgctaatcat |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36474314 |
tccaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttgctaatcat |
36474227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 36465236 - 36465057
Alignment:
| Q |
19 |
atgattcctggtggagcaggagcaactgttttatacaacttgaagaaaagacatccaacacttgacctgcctgtgattgactatgatttagcacttcttt |
118 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||| | ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465236 |
atgattacaggtggagcaggagcaactgttttatacaacttgaggcaaagacacccaacacttgacctgcctgtgattgactatgatttagcacttcttt |
36465137 |
T |
|
| Q |
119 |
ttcaaccaatgttaatgcttggaatcagtcttggtgttgctttcaatctcattttccctgactggatgttaacaactttg |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |||||||||||| ||||| ||||| |
|
|
| T |
36465136 |
ttcaaccaatgttaatgcttggaatcagtcttggtgttgcttttaatgtcatttttcctgactggatgataacatctttg |
36465057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University