View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_635 (Length: 224)

Name: NF10481A_low_635
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_635
NF10481A_low_635
[»] chr7 (1 HSPs)
chr7 (21-207)||(40225396-40225582)


Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 207
Target Start/End: Original strand, 40225396 - 40225582
Alignment:
21 agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40225396 agctatagcaccaaatatataagtggaggaaaaaattacttacaaaaattgaccaagaacgtgggcgtaacgtaaggtttgagtttaatgagagaatgat 40225495  T
121 ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtata 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40225496 ggtgaaaagacaaagctatttcttaaccaagcttcaatgaatttttgtaatggaagaagggaacagagatgaaaggataagggtata 40225582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University