View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_639 (Length: 224)
Name: NF10481A_low_639
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_639 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 34956410 - 34956187
Alignment:
| Q |
1 |
tcatgagcatgagtcttattatggagatcgtgatacagatagccctgttaaggaacacattatatttaatttaaattagcatgatttgtatcattttact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956410 |
tcatgagcatgagtcttattatggagatcgtgatacagatagccttgttaaggtacacattatatttaatttaaattagcatgatttgtatcattttact |
34956311 |
T |
|
| Q |
101 |
ttgaagtgtttatgcttttaagtataattgaacatcactgtttaccattagagtacaacatgcctgatatgaagtgtctctgctgcagacaatggagaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34956310 |
ttgaagtgtttatgcttttaagtataattgaacatcactgtttaccattagagtacaacatgcctgatatgaagtgtctctgctgcagacaatggagaat |
34956211 |
T |
|
| Q |
201 |
atattggcggctttcccttcagag |
224 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
34956210 |
atattggcgtctttcccttcagag |
34956187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University