View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_641 (Length: 223)
Name: NF10481A_low_641
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_641 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 49825338 - 49825117
Alignment:
| Q |
1 |
tatttaaggttggaattacggatgggaacttaatgcataattggcgcaactatgcgggcaaaaggacatctgatgaatcaatttgcgactcttcacaaca |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
49825338 |
tatttaaggttgaaattacggatgggaacttaatgcataattggcgcaactatgctgtcaaaaggacatctgatgaatcaatttgtgactcttcacaaca |
49825239 |
T |
 |
| Q |
101 |
ttacaatgacgaatatcctgctgatctggatttgttcatagacnnnnnnnntgttgtttaaagttgagataactgatggcaacttgaagcatggatggcg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49825238 |
ttacaatggcgaatatcctgctgatctggatttgttcatagac-aaaaaaatgttgtttaaagtcgagataactgatggcaacttgaagcatggatggcg |
49825140 |
T |
 |
| Q |
201 |
taactaagctgtgaagcgggtgt |
223 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
49825139 |
taactaagttgtgaagcgggtgt |
49825117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University