View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_652 (Length: 221)
Name: NF10481A_low_652
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_652 |
 |  |
|
| [»] scaffold0009 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0009 (Bit Score: 170; Significance: 2e-91; HSPs: 3)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 196
Target Start/End: Original strand, 40010 - 40183
Alignment:
| Q |
23 |
tgaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
122 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40010 |
tgaagcagcaaaacgacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctc |
40109 |
T |
 |
| Q |
123 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgatct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40110 |
aaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaacccttgatct |
40183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 25 - 145
Target Start/End: Original strand, 33391 - 33511
Alignment:
| Q |
25 |
aagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtggtcctcaa |
124 |
Q |
| |
|
|||||||||||| ||| || || ||||||||||||||||||||| || |||||| ||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33391 |
aagcagcaaaacgacgtggggtcgaggatctctatctatgcatggtagaagtgaccttgtcgcctaccattttcgtgtgtgaaacacttgtggttctcaa |
33490 |
T |
 |
| Q |
125 |
attggatagattaaatgtacc |
145 |
Q |
| |
|
|||||||||| ||| |||||| |
|
|
| T |
33491 |
attggatagaataattgtacc |
33511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 24 - 116
Target Start/End: Original strand, 21734 - 21826
Alignment:
| Q |
24 |
gaagcagcaaaacaacgcggtgttgaggatctctatctatgcatgttacaagtgatgttgtcacctaccattttcgtgtgtgaaacacttgtg |
116 |
Q |
| |
|
|||| |||||||| ||| || || ||||||||||||||| | ||||| |||||| ||||| |||||||||||||| ||| |||||||||| |
|
|
| T |
21734 |
gaagaagcaaaacgacgtggggtcgaggatctctatctaaacttgttagaagtgaccttgtcgcctaccattttcgtttgtagaacacttgtg |
21826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 191
Target Start/End: Complemental strand, 19970313 - 19970209
Alignment:
| Q |
87 |
cctaccattttcgtgtgtgaaacacttgtggtcctcaaattggatagattaaatgtaccctctatgtctcgcttttcggttgatcttccttcgcttaaaa |
186 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || |||||| ||| || ||||| | |||||| ||| | ||| ||||||||||||||||| |||| |
|
|
| T |
19970313 |
cctaccattttctgctgtgaaacacttgtggttctgaaattgtttagcatacatgtaacaactatgtttcgttcttctgttgatcttccttcgctcaaaa |
19970214 |
T |
 |
| Q |
187 |
ccctt |
191 |
Q |
| |
|
||||| |
|
|
| T |
19970213 |
ccctt |
19970209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University