View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10481A_low_656 (Length: 221)

Name: NF10481A_low_656
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10481A_low_656
NF10481A_low_656
[»] chr6 (1 HSPs)
chr6 (164-199)||(10826323-10826358)


Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 199
Target Start/End: Original strand, 10826323 - 10826358
Alignment:
164 gttgtggttgttcgtctgtcatctcgtctttctact 199  Q
    ||||||||||||||||||||||||||||||||||||    
10826323 gttgtggttgttcgtctgtcatctcgtctttctact 10826358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University