View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10481A_low_656 (Length: 221)
Name: NF10481A_low_656
Description: NF10481A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10481A_low_656 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 164 - 199
Target Start/End: Original strand, 10826323 - 10826358
Alignment:
| Q |
164 |
gttgtggttgttcgtctgtcatctcgtctttctact |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10826323 |
gttgtggttgttcgtctgtcatctcgtctttctact |
10826358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University